Myeloproliferative Neoplasms Driver Mutations Research Articles

Sailing in deceptive calm: Navigating the undercurrents of essential thrombocythaemia.

The discovery of driver mutations in myeloproliferative neoplasms has significantly contributed to the management of patients with essential thrombocythaemia (ET). High-quality evidence has started to pave the way for targeted therapy. The review by Ferrer-Marín etal. further advances this discussion, highlighting how molecular profiling, including non-driver gene mutations, is set to revolutionize personalized treatment approaches for ET patients. Commentary on: Ferrer-Marín etal. Essential thrombocythemia: a contemporary approach with new drugs on the horizon. Br J Haematol 2024 (Online ahead of print). doi: 10.1111/bjh.19403.

Blast Phase of Myeloproliferative Neoplasm Resembles Acute Myeloid Leukemia, Myelodysplasia-Related, in Clinical Presentation, Cytogenetic Pattern, and Genomic Profile, and Often Undergoes Reversion to Second Chronic Phase Status After Induction Chemotherapy.

BCR::ABL-negative myeloproliferative neoplasm (MPN) has a prolonged clinical course, and some cases eventually undergo transformation to blast phase; its pathogenesis remains to be elucidated. To evaluate the clinicopathologic characteristics of MPN in blast phase. The study aimed to retrospectively analyze the clinical and laboratory data of 24 cases. Median latency to blast phase was 48 months (range, 7-384 months). Complex karyotypes were seen in 12 of the 24 cases (50%). Overall, 16 cases (66.7%) exhibited high allele burdens of MPN driver mutations along with increased blasts, consistent with linear clonal evolution, whereas the remainder (8; 33.3%) showed loss or partial loss of the driver mutation suggestive of a parallel evolution. Additional mutations were noted in 23 cases (100%), including TP53 mutations in 10 of 24 cases (41.7%). Following chemotherapy, 15 of the 24 patients (62.5%) reverted to a second chronic phase while retaining or regaining MPN driver mutations and losing blast-related mutations, although 9 of the 15 patients (60%) later died of disease progression. Median overall survival was 10 months (CI, 4.6-15.4), with those harboring complex karyotypes demonstrating decreased survival (6 versus 29 months; P = .004). MPN-blast phase resembles acute myeloid leukemia, myelodysplasia-related, in cytogenetic pattern, mutation profile, and clinical outcome. Two patterns of clonal evolution are inferred by dynamic analysis of mutation profiles: linear and parallel evolutions. Although overall survival was dismal, 62.5% of our cases achieved second chronic phase, and they showed better survival than those without second chronic phase.

The Utility of a Coagulation Laboratory Profile in Addition to Clinical Risk Factors for Thrombosis Risk Evaluation in Patients with Myeloproliferative Neoplasms: A Pilot Study

Background: Patients (pts) with myeloproliferative neoplasms (MPN) have a significantly increased risk of arterial and venous thrombotic events (TEs), while some pts may paradoxically suffer from bleeding manifestations. Thrombosis risk evaluation in polycythemia vera (PV) and essential thrombocythemia (ET) has important implications for patient management, however, the currently used risk stratification models are extremely limited. Methods: We designed a pilot study to assess the utility of an expanded coagulation laboratory profile in addition to other clinical variables for thrombosis and bleeding risk evaluation in a heterogenous MPN patient population. Our laboratory profile included PT, aPTT, fibrinogen, D-dimer, von-Willebrand Factor (vWF) antigen and activity testing, platelet (PLT) aggregation studies and thrombin generation assay (TGA, ST-Genesia, Stago, France), along with CBC and comprehensive biochemistry studies. Blood was drawn from pts visiting the hematology clinics or day care at Hadassah Medical Center. Clinical and demographic data were collected retrospectively from electronic medical records. The study was approved by the local IRB committee. Results:74 pts were included in the study; the mean age was 59.7 years and 51% were women. Sixty percent had a diagnosis of PV, 20% had ET, 17.6% had myelofibrosis (MF) and 2.7% had MPN unclassifiable. 78% of the pts harbored a JAK2V617F mutation, 8% and 2.7% harbored CALR and MPL mutations, respectively, and 11% were negative to all three MPN driver mutations. 63% of the pts had at least one cardiovascular risk factor, most commonly hypertension (HTN) and dyslipidemia. Most of the pts were treated with antiplatelet agents (62%), anticoagulants (16%) and/or cytoreductive agents (58%). Of 74 pts, 31% had a history of TEs (20% arterial, 11% venous), 22% reported suffering from microvascular symptoms, and 20% had experienced bleeding. The high rate of bleeding manifestations in our study population suggests an underestimation of the bleeding burden in MPN, as proposed by our group previously [Rottenstreich, Eur J Intern Med 2017]. Other patient characteristics were overall comparable to MPN patient populations in other studies (Table 1). In multivariate analyses, history of TEs was significantly associated with older age, type 2 diabetes mellitus (DM2), HTN and dyslipidemia, but not with gender, MPN subtype, driver mutation status or smoking. Pts with history of TEs had significantly lower hematocrit and prolonged PT/INR, associated with a higher rate of treatment with cytoreduction and anticoagulation, respectively, in these pts. Interestingly, pts with TEs had significantly higher vWF antigen levels (p=0.007), which were independent of age, blood counts and treatments, a finding not previously reported in MPN. No association was observed between TEs and PLT or WBC counts, D-dimer levels and vWF activity (Table 2), however, vWF activity was decreased in pts with higher PLT counts. TGA was of key interest in this study. In 62 pts not receiving anticoagulation, we observed an association between prolonged lag time (suggesting decreased coagulability) and older age, male gender and (near significant trend) JAK2V617 negative status, but did not find a correlation to TEs, blood counts and other variables. PLT aggregation indices were not associated with TEs, bleeding history or blood counts. In multivariate logistic regression analyses, history of DM2 and HTN, and vWF antigen levels, showed the strongest association to TEs, which was independent of age, blood counts and all other variables. A risk-model incorporating these variables showed a sensitivity of 77% and specificity of 92% for history of TEs in our study population. Conclusions: Despite being limited by a small and heterogenous study population and retrospective data collection; these findings support the utility of a coagulation laboratory profile in the evaluation of thrombosis and bleeding risk in MPN. The potential of TGA in risk evaluation in MPN is intriguing but merits further research. The multivariate risk-model incorporating history of DM2 and HTN along with vWF antigen levels merits validation in larger studies. Based on this pilot, a prospective study following over 250 pts with PV and ET (excluding overt MF) was initiated. This study will include NGS mutational profiling and JAK2V617F allele burden testing and omit the use of PLT aggregation studies.

TP53 mutations and Their Impact on Survival in Patients with Myeloproliferative Neoplasms

Introduction: TP53 mutations in patients with myeloproliferative neoplasms (MPN) are associated with poor prognosis, including progression to blast phase MPN. However, low variant allele fraction (VAF) TP53 mutations have been reported to remain stable over years in chronic phase MPN. A major unmet clinical need in MPN is the ability to discriminate patients with TP53-mutant MPN who are at high-risk of secondary AML (sAML) and warrant immediate intervention from those who are at lower risk of sAML in whom active surveillance can be employed. Therefore, we sought to identify parameters associated with leukemic transformation and overall survival in the context of MPN with genetic aberrations in TP53. Materials and Methods: We retrospectively analyzed a cohort of 947 MPN patients from the Dana-Farber Cancer Institute Hematologic Malignancies Data Repository (HMDR) with at least one clinical next-generation sequencing (NGS) panel performed. Patient characteristics such as age at MPN diagnosis, gender, MPN subtype and driver mutations were recorded. Furthermore, information about the course of disease was extracted including occurrence of sAML and overall survival (Figure 1). We also analyzed type and number of additional mutations as well as cytogenetics. With respect to TP53-specific parameters, we evaluated the number of TP53 mutations, TP53 VAF, loss of heterozygosity (LOH) at the TP53 locus, phenotypic annotations of TP53 (i.e. PHANTM score) and 17p deletion. We defined “multi-hit” TP53 as the presence of two or more TP53 mutations, TP53 VAF higher than 50%, TP53 mutation plus 17p deletionor TP53 mutation and documented LOH. Results: A total of 947 patients were analyzed, of which 40 harbored at least one detectable TP53 mutation. A total of 13 patients were found to have a multi-hit TP53 mutations defined by > 50% VAF in 6 patients, two or more TP53 mutations in 5 patients and TP53 mutation + 17p deletion in 5 patients. The MPN diagnosis at time of TP53 mutation detection was post ET/PV myelofibrosis (secondary MF) (n=23, 58%), primary myelofibrosis (MF) (n=7, 18%), pre-fibrotic MF (n=2, 5%), essential thrombocythemia (ET) (n=6, 15%) and polycythemia vera (PV) (n=2, 5%). Two patients with ET and one patient with PV did not have a concurrent in-house bone marrow biopsy performed at the time the TP53 mutation was detected. Two patients with ET developed sAML within 12 months of TP53 mutation detection, without prior mention of fibrosis. Age at first MPN diagnosis was not significantly different between patients with or without TP53 mutation. The average time from initial MPN diagnosis to detection of the first TP53 mutation was 9 years (range: 0-33 years). The most common MPN driver mutation among patients with TP53 mutations was JAK2 (75%), followed by CALR (13%)and MPL (5%). Out of all TP53-mutated patients, 8% showed a triple negative status. The most frequent additional mutations among patients with TP53 mutations were TET2 (25%), U2AF1 (15%), ASXL1 (13%), and DNMT3A (10%). There was no significant difference between single-hit and multi-hit TP53 status regarding MPN subtype, driver mutations and co-mutations (Table 1). Seven patients (single-hit: 15%, multi-hit: 23%) with a TP53 mutation developed sAML during the course of their disease, compared with only 3% of all patients without a TP53 mutation and 50% (single-hit: 41%, multi-hit: 69%) were deceased at the time of the last follow-up compared to 18% of all patients without a TP53 mutation. We focused on overall survival from the initial MPN diagnosis and considered whether patients developed bone marrow fibrosis during their disease course (Figure 1). Survival did not differ significantly between single-hit TP53 and patients with multi-hit TP53 (p=0.2), but survival did differ significantly between multi-hit TP53 patients and TP53 wildtype patients with MF/prefibrotic MF/Secondary MF (p=0.02) as well as compared to all MPN patients without a TP53 mutation (p<0.001). Survival was not significantly different between single-hit TP53 and TP53 wildtype MF/prefibrotic MF/Secondary MF patients (p=0.4). Conclusions: In a large cohort of 947 molecularly characterized MPN patients, 4% of the cohort developed a TP53 mutation during their course of disease. 18% of all TP53-mutant patients developed sAML with an adverse effect on overall survival for patients with multi-hit but not single-hit TP53 mutations.

Mutations in the RNA Splicing Factors U2AF1 and SRSF2 are Context-Dependent in Myeloproliferative Neoplasms

RNA splicing factor gene mutations are recurrently found in BCR::ABL1 negative myeloproliferative neoplasms (MPN). To understand the interactions between spliceosome gene mutations and MPN phenotypic driver mutations ( JAK2, CALR and MPL), we investigated their patterns of co-occurrence or mutual exclusivity in a cohort of 990 MPN patients with comprehensive molecular profiling and clinical information from the Hematologic Malignancies Data Repository (HMDR). As expected, MPN driver mutations ( JAK2, CALR and MPL) were mutually exclusive (N=658, N=168, N=53 respectively, Log2 OR≤-3.5 and Padj. ≤0.005 using pairwise Fisher's exact tests with Benjamin Hochberg multiple testing correction). Additionally, cases with co-occurring mutations in two RNA splicing factors, SF3B1, U2AF1 and SRSF2 (N=44, N=49, N=44) respectively were uncommon (2/135 splicing factor mutated cases) . We further found that U2AF1 and SRSF2 mutations co-occurred with JAK2 (log2 OR=1.7, Padj.=0.009) and MPL (log2 OR=2.1, Padj.=0.006) respectively, but rarely with CALR mutations (N=2 CALR-U2AF1 log2 OR=-2.3 Padj.=0.025, N=2 CALR-SRSF2 log2 OR=-2.2 Padj.=0.048). In contrast, CALR-SF3B1 mutations occurred at the expected frequency (Padj.=0.11). To explore the molecular settings where these mutations co-occur, we investigated the variant allele frequencies (VAFs) of CALR, U2AF1, SRSF2 and concomitant mutations in the CALR-U2AF1 (N=2) and CALR-SRSF2 (N=2) patients. The VAFs for the mutations detected in the first patient with CALR-U2AF1 co-mutation were: CALR 0.26, U2AF1 0.45, and TET2 0.41. Since CALR and splicing factor mutations are typically heterozygous, this suggests the CALR mutation was sub-clonal to the U2AF1 mutation and that U2AF1 and TET2 mutations were likely present in the same cell. In the second CALR-U2AF1 co-mutant case, VAFs were: CALR 0.31, U2AF1 0.27, and TP53 0.16. It is possible that in this case, the CALR and U2AF1 mutations may have occurred in independent clones or may have occurred in the same cell in the absence of other pathogenic mutations. For the two CALR-SRSF2 patients, data from three samples revealed VAFs of 0.23-0.46 for CALR and 0.21-0.58 for SRSF2 mutations. Considering their typical heterozygous occurrence, we inferred those individual cells harbored both CALR and SRSF2 mutations. Notably, in samples with high VAFs (>0.37) for both CALR and SRSF2 in two separate patients, additional high VAF pathogenic mutations were observed: 0.35 for ASXL1 and 0.46 for RUNX1 respectively. As ASXL1 and RUNX1 mutations also typically occur in a heterozygous manner, we hypothesized that when CALR and SRSF2 mutations are present in the same cell, another pathogenic co-mutation may be required for survival of the clone. To test our hypothesis, we FACS-sorted single lineage negative CD34 positive bone marrow cells from the first CALR- SRSF2 co-mutant case into 96 wells plates containing methylcellulose and hematopoietic growth factors (CFU-GEMM). DNA was harvested from single-cell colonies and genotyped for the following mutations using polymerase chain reaction (PCR) followed by gel electrophoresis and Sanger sequencing: CALR c.1154_1155insTTGTC p.K385fs*, SRSF2 c.284G>T p.P95H, ASXL1 c.1926_1927insG p.G642fs*, EZH2 c.2188_2212delAAAAAACAGCTCTTCGCCAGTCTGG p.F729fs*. Bulk NGS VAFs were 0.46, 0.38, 0.35, and 0.17, respectively. Out of 73 colonies analyzed, 71 colonies had the CALR insertion 5 mutation detected (see figure). Among these 71 CALR-mutated colonies, SRSF2 was found to co-occur in 35 colonies. Interestingly, all 35 colonies were accompanied by an ASXL1 mutation, and 29 of them had an additional EZH2 mutation. These findings support our hypothesis that CALR and SRSF2 mutations may co-occur in the same cell in the presence of another pathogenic mutation. Our findings offer molecular insights into the context-dependent behavior of splicing factor mutations in MPN. While they can co-occur with JAK2 and MPL mutations, U2AF1 and SRSF2 mutations are largely mutually exclusive with CALR mutations. In addition, our findings generate two main biological hypotheses: (i) a synthetic lethal relationship may exist between CALR mutations and SRSF2 or U2AF1 mutations, and (ii) this synthetic lethality may be overcome by the presence of additional pathogenic mutation(s) in the cell. Validation studies are ongoing to address these hypotheses. AM and AEM contributed equally.

Glutamine Metabolism Is Altered in Myeloproliferative Neoplasms and Represents a Potential Novel Therapeutic Target

Cancer cells exhibit metabolic reprogramming to ensure sufficient production of macromolecules used to promote cell growth and proliferation. Previous studies have shown that proliferating cancer cells rely significantly on glutamine metabolism as a source of nitrogen and carbon to facilitate nucleotide and lipid biosynthesis, respectively, and to generate metabolites and/or maintain redox homeostasis. Despite this phenomenon being well characterized in many different solid and blood cancer types, very few studies have investigated the metabolic landscape of myeloproliferative neoplasms (MPNs). Glutamine catabolism begins via the uptake of glutamine through sodium-dependent transporters such as SLC1A5, and its transport to the mitochondria where it then undergoes deamination by glutaminase (GLS1) to produce glutamate. This conversion by GLS1 is the rate limiting step in the central glutaminolysis axis, making it a preferential point of study and therapeutic targeting. Indeed, many studies have explored the glutaminolysis pathway in a variety of cancers to decipher potential targets for treatment, but these studies have been extremely limited in MPNs and the potential mechanisms with respect to MPN driver mutations (CALR, JAK2, MPL) and their differential utilization of glutamine have yet to be fully explored. One previous study demonstrated that in JAK2V617F mutant-Ba/F3 cells, GLS1 expression was significantly increased and that GLS1 inhibition served as a promising intervention to suppress colony formation in patient samples but not healthy donors. To more comprehensively decipher the role of glutamine metabolism in MPNs driven by all three driver mutations ( CALR, JAK2, and MPL), we performed RNA-sequencing analysis on peripheral blood mononuclear cells (PMBCs) from MPN patients and found that genes involved in glutamine metabolism are significantly altered across the board. In contrast to the previous study mentioned above, our data demonstrate that GLS1 is not significantly up-regulated, and that MPN PBMCs are not sensitive to GLS1 inhibition. Rather, we characterized another key enzyme in glutamine metabolism, glutamine synthetase (GS) as a molecular and metabolic dependency in MPNs. GS catalyzes the reversion of glutamate into glutamine and serves to regulate nitrogen metabolism, support nucleotide biosynthesis, and most importantly synthesize glutamine to satiate the demand caused by the cancer cells' affinity for high glutamine levels. We found that GS is significantly up-regulated at the mRNA, protein, and activity level in MPNs driven by all three driver mutations, and that genetic and pharmacological inactivation of GS abrogates MPN cell proliferation in vitro. In summary, we have demonstrated that GLS1 may not be an effective therapeutic target for MPNs, and instead characterize GS as a novel dependency and potential point of therapeutic intervention.

Galectin-1 Fuels Monocyte-Driven Hyperinflammation and Represents a Novel Therapeutic Target in Myeloproliferative Neoplasms

JDP and STO co-corresponding authors Previous studies by our group and others have demonstrated that monocytes play a key role in driving hyperinflammation in myeloproliferative neoplasms (MPNs), and that aberrant inflammatory cytokine signaling contributes to disease progression and poor prognosis in MPNs. To interrogate relationships between cellular sources and targets of inflammatory cytokines, we performed single cell RNA-seq (scRNA-seq) in PBMCs and progenitor cells from MPN patients and healthy controls. Monocytes from MPN patients displayed significant enrichment of inflammation-relevant genes as expected. Cell-cell communication networks inferred from expression of ligands and receptors predicted monocytes as a pivotal mediator of cell interactions. Further analysis revealed galectin signaling as one of the most robust input/output pathways for monocytes and significant enrichment of LGALS1 (galectin-1) expression in MPN monocytes. Galectins are a class of proteins that bind specifically to β-galactoside carbohydrates, such as N-linked or O-linked glycosylated proteins. Abnormal expression of galectins in various cancers has been found to mediate broad biological functions, including cell proliferation, apoptosis, adhesion, and inflammation. However, the mechanisms by which galectins contribute to MPN pathogenesis remain incompletely understood. To corroborate our sRNA-seq findings, we performed flow cytometry analysis which demonstrated elevated expression of galectin-1 in MPN patient CD14+ monocytes. Increased plasma levels of galectin-1 were also identified in MPN patients compared to healthy individuals. Higher galectin-1 protein levels in both Kit+ progenitor cells and CD11b+ myeloid cells from Jak2 V617F knock-in mice were also observed when compared to wild type mice. Additionally, galectin-1 expression was induced by MPL W515L and JAK2 V617F and inhibited by ruxolitinib in Ba/F3 cells. Thus, our results show enrichment of galectin-1 in both MPN patients and mouse models, with evidence of direct contribution from specific MPN driver mutations. Our scRNA-seq dataset analysis showed significant correlations of galectin-1 expression with inflammatory and oxidative phosphorylation (OXPHOS) genes in MPN patient monocytes. To investigate the effects of galectin-1 in monocyte activation, we incubated CD14+ monocytes from MPN patients with recombinant galectin-1 (rGal-1) and observed markedly stimulated secretion of inflammatory cytokines, such as IL-1α, IL-1β, IL-6, IL-8 and TNF-α. Furthermore, OTX008, a galectin-1 inhibitor, inhibited the transcription and secretion of inflammatory cytokines in MPN patient CD14+ monocytes and monocytic cell lines. Notably, both genetic and pharmacologic inhibition of galectin-1 reduced cellular ATP level and oxygen consumption rate, suggesting a metabolic reprogramming in MPNs. Although galectin-1 mediates broad biological functions, the molecular mechanisms by which galectin-1 regulates signaling pathways and transcription in MPN cells had not been delineated. Our scRNA-seq heterogeneity analysis suggested that genes in the PI3K-AKT-mTOR pathway were differentially expressed between galectin-1 high- and low-expressing monocytes. We therefore incubated both monocytic cell lines and monocytes from MPN patients with rGal-1 and observed stimulation of the PI3K-AKT-mTOR pathway, represented by increased levels of phosphorylated mTOR, AKT and S6. Consistently, genetic and pharmacologic inhibition of galectin-1 inhibited activation of the PI3K-AKT-mTOR pathway. In summary, our results demonstrate upregulation of galectin-1 in MPN monocytes, potentially due to activation of JAK2-driven signaling. We further demonstrate that galectin-1 fuels inflammation potentially via metabolic reprogramming of monocytes and activation of PI3K-AKT-mTOR signaling. Our data also suggest galectin-1 as a putative therapeutic target in MPNs.

Aberrant Activity of the Calcium Sensor STIM1 Underlies Congenital Platelet Disorders and Myeloproliferative Neoplasms

MB and VA equal contributors AB and STO co-corresponding authors This study was initiated following evaluation of a 32 year-old woman who presented with a history of thrombocytopenia identified in childhood who subsequently developed features of myelofibrosis (MF). A bone marrow biopsy demonstrated hypercellularity in conjunction with megakaryocyte hyperplasia and marked reticulin fibrosis. Molecular testing for JAK2, CALR, and MPL mutations was negative. Given the unusual association between congenital thrombocytopenia and MF in this patient, exome sequencing was performed, revealing a heterozygous R304W mutation in the coiled coil (CC) domain of STIM1. Activating mutations in the CC and EF hand domains of STIM1 have been associated with Stormorken syndrome, a rare congenital platelet disorder associated with abnormal store operated calcium entry (SOCE). We subsequently identified a second patient with MF associated with a STIM1 activating mutation. This individual was found to have severe thrombocytopenia at birth, and exome sequencing revealed a heterozygous S88G mutation in the EF hand of STIM1. A bone marrow biopsy obtained at 6 months of age revealed atypical megakaryocytes and grade 1-2 MF. A repeat biopsy at age 2 showed persistence of stable MF. The unusual finding of MF in these two patients suggested the possibility of altered calcium signaling as a shared mechanism driving congenital platelet disorders such as Stormorken syndrome and myeloproliferative neoplasms (MPNs) including MF. In support of this notion, we identified elevated STIM1 expression in MF vs normal megakaryocyte progenitors, as well as in platelets from patients with essential thrombocythemia (ET) vs healthy controls. Additionally, we found that STIM1 expression was significantly elevated in CD34+ hematopoietic stem/progenitor cells (HSPCs) from both ET and MF patients vs healthy controls. Notably, STIM1 expression was increased in both JAK2 and CALR-mutant MF patients. Collectively, these findings provide evidence of aberrant STIM1 expression in MPN patient cells. To determine the functional role of STIM1 in MPN disease development, colony assays and patient-derived xenograft (PDX) experiments were performed with MF patient CD34+ cells subjected to CRISPR ablation of STIM1. Strikingly discordant results were observed with JAK2 vs CALR-mutant patient samples. Abrogation of STIM1 in CALR-mutant CD34+ cells led to decreased colony formation, and NSGS mice engrafted in parallel with STIM1-targeted cells exhibited decreased human CD45+ cell engraftment in conjunction with prolonged survival. These findings suggest an important role for STIM1 in CALR-mutant MPN disease phenotypes. In contrast, targeting of STIM1 in JAK2-mutant CD34+ cells led to increased colony formation and exacerbated disease phenotypes in vivo as manifested by enhanced human CD45+ cell engraftment, worsened splenomegaly, and early lethality. Similar results were obtained in experiments utilizing pharmacologic inhibitors of SOCE activity. Taken together, these findings indicate that the consequences of aberrant STIM1 activity may be context-dependent relating to specific MPN driver mutations. To expand these observations, we identified a separate cohort of 9 family members in Italy with Stormorken syndrome and confirmed STIM1 EF hand mutations. In ex vivo megakaryocytic differentiation assays, cells from affected individuals exhibited a defect in proplatelet formation. These observations were corroborated by initial analyses of a newly generated Stim1 R304W conditional knock-in mouse which recapitulated the characteristic thrombocytopenia found in patients with Stormorken syndrome. In summary, this study represents the first demonstration of MF development in patients with Stormorken syndrome, thereby uncovering a previously unrecognized hallmark of altered calcium signaling via aberrant STIM1 activation underlying Stormorken syndrome and MPNs. Our findings suggest distinct mechanisms relating to the interaction between JAK2 vs CALR mutation and altered STIM1 activity. Further studies of these relationships may have important ramifications for potential therapeutic approaches targeting these pathways.

GLS in Philadelphia-negative and JAK2 V617F-driven myeloproliferative neoplasms (MPNs).

e15092 Background: Philadelphia-negative myeloproliferative neoplasms (MPNs) are clonal hematopoietic malignancies. Nearly all MPNs are driven by somatic mutations in either: JAK2, CALR, or MPL. Although all three MPN driver mutations lead to constitutive activation of JAK/STAT signaling, JAK inhibitors are not curative and fail to alter disease progression and display unwanted side effects. Allogeneic stem cell transplantation remains the only curative therapy for MPNs, but is associated with substantial morbidity and mortality. Recently, glutaminolysis has been shown to play a critical role in cancer cell metabolism. During glutaminolysis, glutamine is metabolized through in a two-step reaction, the first of which involves the enzyme glutaminase (GLS) catalyzing the hydrolysis of glutamine to glutamate. Glutamate can then fuel for energy production into the TCA cycle, among several other possible metabolic fates. As many cancers have proven to be dependent on this pathway, targeting GLS has become an attractive therapeutic avenue. Because glutaminolysis has been understudied in MPNs, we sought to determine whether this pathway represents a novel, targetable vulnerability in MPNs. Methods: We evaluated the mRNA levels of GLS in peripheral blood mononuclear cells from 30 MPN patients and 5 healthy donors. We tested by qPCR for GLS and the protein levels of GLS by western blot in TF-1 cells, a human myeloid cell line, stably overexpressing either JAK2, MPL, or CALR mutated proteins. The latter also under treatment with the JAK inhibitor ruxolinitinib. We also evaluated the GLS enzyme activity through the use of a fluorimetric assay. Lastly, we tested the sensitivity of MPN cells to GLS inhibition with a GLS inhibitor, CB-839, which is currently in advanced phase clinical trials for other cancers including Myelodysplastic Syndromes. Results: GLS mRNA expression was increased in all MPN patients regardless of their driver mutation, where expression in JAK2V617F patients was higher in MF versus ET patients (p < 0.001). GLS protein expression and activity were increased in TF-1 cells expressing JAK2, MPL, and CALR mutations. We also found that GLS mRNA and protein expression was up-regulated in a JAK/STAT-dependent manner. Interestingly, despite increased expression of GLS across all MPN driver mutations, only JAK2 V617F cells demonstrated significant sensitivity to GLS inhibition with CB-839 in vitro and with preliminary data in vivo. We found that combination treatment with JAK inhibitor ruxolitinib further inhibited cell viability. Conclusions: GLS up-regulation is a common feature of all MPNs, and is JAK/STAT dependent. JAK2 V617F expressing cells show significant sensitivity to GLS inhibition. Combination treatment with ruxolitinib further enhances this effect. Treatment with CB-839 may thus represent a novel therapeutic avenue for JAK2 V617F+ MPNs.

Machine Learning Improves Risk Stratification in Myelofibrosis: An Analysis of the Spanish Registry of Myelofibrosis.

Myelofibrosis (MF) is a myeloproliferative neoplasm (MPN) with heterogeneous clinical course. Allogeneic hematopoietic cell transplantation remains the only curative therapy, but its morbidity and mortality require careful candidate selection. Therefore, accurate disease risk prognostication is critical for treatment decision-making. We obtained registry data from patients diagnosed with MF in 60 Spanish institutions (N = 1386). These were randomly divided into a training set (80%) and a test set (20%). A machine learning (ML) technique (random forest) was used to model overall survival (OS) and leukemia-free survival (LFS) in the training set, and the results were validated in the test set. We derived the AIPSS-MF (Artificial Intelligence Prognostic Scoring System for Myelofibrosis) model, which was based on 8 clinical variables at diagnosis and achieved high accuracy in predicting OS (training set c-index, 0.750; test set c-index, 0.744) and LFS (training set c-index, 0.697; test set c-index, 0.703). No improvement was obtained with the inclusion of MPN driver mutations in the model. We were unable to adequately assess the potential benefit of including adverse cytogenetics or high-risk mutations due to the lack of these data in many patients. AIPSS-MF was superior to the IPSS regardless of MF subtype and age range and outperformed the MYSEC-PM in patients with secondary MF. In conclusion, we have developed a prediction model based exclusively on clinical variables that provides individualized prognostic estimates in patients with primary and secondary MF. The use of AIPSS-MF in combination with predictive models that incorporate genetic information may improve disease risk stratification.

Emergence of Chronic Myeloid Leukemia in Patients with Myeloproliferative Neoplasms: A Single-Institution Experience

Introduction: Chronic myeloid leukemia (CML) is characterized by the presence of the BCR-ABL1 translocation and is typically distinct from other myeloproliferative neoplasms (MPN) including polycythemia vera (PV), essential thrombocythemia (ET) and myelofibrosis (MF). Concurrent diagnosis of CML and MF is uncommon and infrequently described in case reports.1 Moreover, very few cases have been described of CML occurring after an established diagnosis of MPN.2-3 Due to the rarity of concurrent CML and MPN, management strategies in this population are not defined. In addition, the latency time from the emergence of BCR-ABL1 positive clones to a clinical diagnosis of CML in this setting is largely unknown. To address these questions, we interrogated our institutional experience and retrospectively analyzed available specimens. Methods: We collected information on patients seen at Massachusetts General Hospital (MGH) from January 1 2012 to January 1 2022 for CML occurring after an established diagnosis of MPN. Available stored samples were retrospectively tested for BCR-ABL1 with a fusion transcript assay (MGH Center for Integrated Diagnostics, Boston, MA). Results: We identified four patients with CML preceded by MPN (Table 1). Three patients had prior MF, diagnosed 4.3-7.6 years before the onset of CML; two of these had post-ET MF. Patient #4 had ET diagnosed 4 years prior to onset of CML, then went on to develop MF 4.9 years after CML diagnosis. None of the patients were on JAK inhibitors, hydroxyurea or interferon at the time of CML diagnosis. All patients had a leukocytosis with characteristic features on the differential prompting evaluation for CML. The median white blood cell count was 45.83 x 10^9/L (range 27.49-121.02). All four patients had an elevated basophil count (median 2.99 x 10^9/L, range 1.1-22.99) and two had an elevated eosinophil count (median 1.11 x 10^9/L, range 0.55-44.17). Regarding MPN driver mutations, one patient had a JAK2 V617F, one patient had a CALR exon 9 deletion, and two patients had no identifiable mutations on extended next-generation sequencing. For CML treatment, three patients received dasatinib (two with 100 mg daily, one with 50 mg daily), whereas one received nilotinib (150 mg twice daily). Two achieved a major molecular response (MMR) (at 7 and 8 months); one had an early molecular response at 6 months (last follow-up); one (with e13-a3 transcript) could not be quantified on a standard PCR assay but achieved a complete cytogenetic response by 4 months. At the time of last follow-up, two patients were in MMR on tyrosine kinase inhibitors (TKI), whereas two underwent allogeneic hematopoietic cell transplantation (alloHCT), primarily for progression of MF. We retrospectively interrogated available samples for evidence of the BCR-ABL1 translocation prior to a clinical diagnosis of CML. Patient #2 was followed at MGH for MF and thus had available samples. We identified BCR-ABL1 transcripts in the peripheral blood three months prior to his clinical diagnosis of CML (unable to be quantified due to e13-a3 transcript); there were no available samples from earlier in his disease course for testing (Figure 1). Discussion: CML can emerge in patients with MPN. Herein, we describe four cases of this phenomenon. Signs of CML evolution included marked leukocytosis, as well as basophilia and eosinophilia. Despite underlying MF, three patients tolerated full-dose TKI and achieved molecular responses early in their disease course. However, MPN progression remained a significant challenge, with two patients ultimately requiring an alloHCT. Of note, we found evidence of BCR-ABL1 in the peripheral blood three months prior to clinically apparent CML in one patient. Experiments using single cell techniques in patients with concurrent MPN and CML would provide insights into the clonal architecture and are in planning stages.

Machine Learning Improves Risk Stratification in Myelofibrosis: An Analysis of the Spanish Registry of Myelofibrosis

Purpose Myelofibrosis (MF) is a myeloproliferative neoplasm (MPN) with a heterogeneous clinical course. Allogeneic hematopoietic cell transplantation remains the only curative therapy, but its significant morbidity and mortality require careful candidate selection. Therefore, accurate disease risk prognostication is critical for treatment decision making. Patient and Methods Registry data were retrieved from patients diagnosed with MF between January 2000 and October 2021 in 59 Spanish institutions. A total of 1,386 patients were randomly divided into a training set (80% of the cohort) and a test set (20% of the cohort). A machine learning (ML) technique (random forests) was used to model overall survival in the training set and validate the results in the test set. Results The ML model, based on eight clinical variables determined at diagnosis, achieved high accuracy in predicting overall survival (training set c-index, 0.750; test set c-index, 0.744) and leukemia-free survival (training set c-index, 0.697; test set c-index, 0.703). We confirmed the superiority of the model compared with the IPSS in the prediction of survival at all time points evaluated (Figure 1A). Importantly, the model was superior to the IPSS regardless of age range (<60 or >60 years). We derived 4 equally distributed groups of patients from the model predictions, comprising 25% of patients each. By comparing this distribution with the IPSS risk groups, we observed that circa 50% of patients were reassigned to a different risk group by the ML algorithm (Figure 1B). Additionally, we did not observe any benefit from including MPN driver mutations or high-risk somatic mutations in the model. Furthermore, the ML model outperformed the prognostic accuracy of the MIPSS70 in primary MF and the MYSEC-PM in secondary MF. Conclusion The AIPSS-MF (Artificial Intelligence Prognostic Scoring System for Myelofibrosis) is based exclusively on clinical variables that are readily available in any healthcare facility. This simple model has demonstrated high prognostic accuracy for predicting survival in patients with primary and secondary MF, outperforming other well-established risk scoring systems. An interactive web calculator of this model can be accessed in the following link: https://geneticsoncohematology.com/MF/ Figure 1View largeDownload PPTFigure 1View largeDownload PPT Close modal

Thrombosis with Non-Proliferative Complete Blood Count Indicative of Underlying Myeloproliferative Neoplasm, Sythrom, a Study on Behalf of the FIM Group

Introduction Thrombosis is the main cause of morbidity in myeloproliferative neoplasms (MPN) and can be the mode of revelation of these malignant diseases. Most of them are characterized by specific driver mutations such as JAK2 V617F, CALR or MPL. An idiopathic or atypical thrombotic event justifies looking for MPN by searching these MPN-related mutations, even in the absence of myeloproliferative features on the complete blood count (CBC). This is especially crucial in case of splanchnic and cerebral thromboses, but not only. In this context the diagnosis of MPN and the choice of treatment are made difficult by the absence of increased blood counts. Objectives - To constitute an observational cohort of patients (pts) presenting an arterial or venous thrombotic event leading to a suspicion of MPN without signs of myeloproliferation in CBC. - To study the characteristics of pts at diagnosis, the rate of recurrence of thrombosis and the rate of hematological progression. Patients and method Inclusion criteria were as follows: i)-diagnosis of an arterial or deep venous thrombotic event, ii)-CBC not suggestive of polycythemia vera (PV), essential thrombocythemia (ET) or myelofibrosis (MF) (CBC below WHO 2016 thresholds) but iii)-detection of a molecular abnormality (JAK2, CALR or MPL driver mutations) and/or an abnormality on bone marrow trephine in favor of MPN and/or spontaneous progenitor growth. Data were collected retrospectively and prospectively. The study is registered on ClinicalTrial.gov (NCT04539678). Results Between 05/2019 and 06/2022, the participation of 31 centers in France and Switzerland allowed the collection of data from 216 pts. The analysis is presented for 208 pts after exclusion of incomplete non-evaluable cases (n=5) or those not meeting inclusion criteria (n=3). The M/F sex ratio was 1.3 with a median age of 55 years (22-91) at the date of molecular testing. Inaugural thrombosis was venous (80%) or arterial (20%) and involved either splanchnic (50%), cerebral (24%), other locations (23%) or multiple territories (3%). Median CBC values were hemoglobin 14 g/dL, hematocrit 43%, platelets 298x109/L and leukocytes 7,1 x109/L. Pts had either a driver mutation of JAK2 V617F (n=201), CALR (n=2) or MPL (n=2), or none of these but spontaneous progenitor growth (n=3). According to WHO criteria, the diagnoses retained were MPN in 91 (44%) cases (including 26 PV, 4 MF and 61 unclassifiable MPN), while 38 pts (18%) lacked MPN criteria and 79 (38%) were not assessable (no trephine). A clinical follow-up of at least 3 months was available in 197 pts, with a median of 61 months (range 3 months - 36 years). Recurrent thrombosis occurred for 42 pts (21%, respectively 24% of initially arterial and 19% of initially venous). Recurrence was splanchnic for 13 pts (31%). The median delay of recurrence was 37 months (12 days - 18 years) after the thrombotic event that led to a suspicion of MPN. Recurrence occurred more often in pts with initially non-splanchnic thrombosis (30% vs. 13% p=0.004). Thrombosis recurrences were not significantly different between pts classified as MPN and those without MPN criteria (18% vs. 30% p=0.1). Hematological progression was observed for 27 pts with a median delay of 31 months (1 - 105) since thrombosis. According to WHO MPN criteria, they were 9 PV, 14 TE and 4 MF. Pts with thrombotic recurrence more frequently presented hematological progression or died (31 month progression-free survival [PFS] 85% vs 94% p=0.008). PFS was significantly reduced in cases of initially non-splanchnic thrombosis (86% vs 97% at 31 months p<0.0001). An explanation could be that pts with splanchnic thrombosis were more frequently treated with cytoreductive agents (CRA) (71% vs 41% p=0.03). Analysis of the effect of antithrombotic therapy is ongoing. Conclusion Thrombosis cases with a non-proliferative CBC but with MPN driver mutations leading to MPN suspicion constitute a heterogeneous group of pts, with many cases of non-splanchnic involvement. The latter pts show more frequent thrombotic recurrences and hematological progression than pts with splanchnic involvement. The role of cytoreduction and antithrombotic therapies needs to be explored in this context.

Spatial Organization of Hematopoietic Clones in the Bone Marrow of a Patient with Polycythemia Vera

All humans become genetic mosaics over time as our stem cells acquire somatic mutations throughout life. In the hematopoietic compartment, this phenomenon is termed clonal hematopoiesis (Steensma et al. 2015). Clonal hematopoiesis (CH) increases in prevalence with age and is associated with an increased risk for hematologic malignancy (Genovese et al. 2014; Jaiswal et al. 2014; Xie et al. 2014). CH harboring JAK2 mutations are frequently observed in healthy individuals; and yet JAK2 mutations are also the most frequent drivers of myeloproliferative neoplasms (MPNs) such as polycythemia vera (PV). MPNs are clonal diseases marked by dysregulated hematopoiesis and can progress to a secondary myelodysplastic syndrome or acute leukemia. There is increasing evidence that the clonal mutations driving MPNs arise early in life-potentially in utero-often years before the development of symptoms (Williams et al. 2022). While the intrinsic factors driving clonal expansion are increasingly known (Watson et al. 2020), the extrinsic factors driving the expansion of clones harboring these MPN driver mutations are not well characterized. Prior work has shown that clonal mutations are geographically constrained in solid organs such as skin, colon and esophagus (Lee-Six et al. 2018; Martincorena et al. 2015, 2018). Strikingly, in the esophagus non-malignant NOTCH1 mutant clones can even outcompete nascent malignant clones (Colom et al. 2021). In the hematopoietic compartment, the spatial organization of clones harboring these mutations and their interaction with the niche and each other is largely unknown. We hypothesized that clonal mutations are geographically constrained in the bone marrow niche as is seen in solid organs. To answer these questions, we developed methods for spatially-aware clonal mutation detection. As proof of principle, we characterized the hematopoietic clonal organization within a femur head explant from a 50 year-old man with PV undergoing hip arthroplasty. Briefly, the femur head was sectioned into 2mm slices, which were then further partitioned into approximately 300 bone marrow fragments (2mm3). Approximately 20% of the fragments were snap frozen and pulverized for DNA extraction. The remainder were formalin fixed and decalcified for correlative imaging. Targeted error-corrected sequencing was performed using a myeloid-specific panel (Duncavage et al. 2018) on 24 bone marrow fragments, and bulk peripheral blood and bone marrow aspirate. In the peripheral blood, JAK2 V617F (0.24 VAF) and TET2 L1081* (0.02 VAF) mutations were identified. In the bone marrow aspirate, the same JAK2 (0.62 VAF) and TET2 (0.05 VAF) mutations were identified in addition to a DNMT3A R882C mutation (0.02 VAF). Interestingly, peripheral blood sequencing two years prior identified the JAK2 and DNMT3A mutations, but not the TET2 mutation, suggesting recent clonal expansion of TET2 mutant clone. From the 24 sequenced bone marrow fragments, the geographical organization of clonal mutations in the bone marrow was determined (Figure 1). The JAK2 V617F clone was identified in all bone marrow fragments sequenced (0.12-0.69 VAF). The TET2 L1081* clone was identified in 11/24 bone marrow fragments with some regional constraint (0.03-0.05 VAF). The DNMT3A R882C mutation was detected in only a single bone marrow fragment (0.02 VAF) and co-localized with the JAK2 V617F and TET2 L1081* mutations. A previously undetected clonal SETBP1 E616V mutation was identified in two adjacent bone marrow fragments from sequential slices of the femur head (0.05 VAF and 0.10 VAF). Together this provides the first characterization of spatial organization of clonal mutations in the bone marrow niche for an MPN patient. Currently, we are utilizing digital droplet PCR targeting these detected mutations in ~60 additional bone marrow fragments to accurately quantify clone size across the tissue. We plan to employ multiplex fluorescent imaging of bone marrow fragments adjacent to detected clusters of mutations to identify the surrounding bone marrow niche elements in those regions. These findings suggest that bone marrow biopsy from a small section of bone marrow may not accurately describe disease state and clonal mutation burden in myeloid neoplasms. Future applications of these tools will help describe the extrinsic factors and local microenvironment that drive clonal evolution over time in the bone marrow. Figure 1View largeDownload PPTFigure 1View largeDownload PPT Close modal

Clonogenic assays improve determination of variant allele frequency of driver mutations in myeloproliferative neoplasms

Molecular diagnostics moves more into focus as technology advances. In patients with myeloproliferative neoplasms (MPN), identification and monitoring of the driver mutations have become an integral part of diagnosis and monitoring of the disease. In some patients, none of the known driver mutations (JAK2V617F, CALR, MPL) is found, and they are termed “triple negative” (TN). Also, whole-blood variant allele frequency (VAF) of driver mutations may not adequately reflect the VAF in the stem cells driving the disease. We reasoned that colony forming unit (CFU) assay–derived clonogenic cells may be better suited than next-generation sequencing (NGS) of whole blood to detect driver mutations in TN patients and to provide a VAF of disease-driving cells. We have included 59 patients carrying the most common driver mutations in the establishment or our model. Interestingly, cloning efficiency correlated with whole blood VAF (p = 0.0048), suggesting that the number of disease-driving cells correlated with VAF. Furthermore, the clonogenic VAF correlated significantly with the NGS VAF (p < 0.0001). This correlation was lost in patients with an NGS VAF <15%. Further analysis showed that in patients with a VAF <15% by NGS, clonogenic VAF was higher than NGS VAF (p = 0.003), suggesting an enrichment of low numbers of disease-driving cells in CFU assays. However, our approach did not enhance the identification of driver mutations in 5 TN patients. A significant correlation of lactate dehydrogenase (LDH) serum levels with both CFU- and NGS-derived VAF was found. Our results demonstrate that enrichment for clonogenic cells can improve the detection of MPN driver mutations in patients with low VAF and that LDH levels correlate with VAF.

P983: SINGLE CELL ANALYSIS ALLOWS THE EARLY DETECTION OF LEUKEMIC CLONES IN MPN PATIENTS

Background: Myeloproliferative neoplasms (MPNs) are a group of hematopoietic stem cell disorders resulting in the overproduction of myeloid differentiated cells. Primary Myelofibrosis (PMF) is characterized by the worst prognosis and 15-20% of cases develop secondary Acute Myeloid Leukemia (AML). MPNs driver mutations affect JAK2, CALR or MPL genes. Moreover, mutations in epigenetic regulators can exacerbate the disease and alter response to treatment. Our group recently demonstrated through single cell analysis that MPNs progression is due to increased genetic heterogeneity, loss of heterozygosity and parallel AML evolution. Aims: In this work we sought to define the genomic architecture of MPN patients during disease evolution, and gain insight into the chromatin and transcriptional perturbations induced by epigenetic modifiers’ mutations. Methods: In order to describe MPNs clonal hierarchy at the single cell level, we employed Mission Bio Tapestri platform. We analyzed the CD34+ compartment of 3 patients during the chronic phase of the disease and after leukemic transformation through a custom panel comprising 29 genes frequently mutated in myeloid neoplasms. CNV assessment was performed on the same data through Mosaic algorithm. On one patient, single nucleus RNA (snRNA-seq) and ATAC-seq were then conducted through 10x genomics instrument on CD34+ cells from the chronic and blast phase. Data were analyzed through Seurat R package. Results: Genomic analysis was performed on 20.652 single cells coming from 7 samples. The analyzed patients suffered from Essential Thrombocythemia (n=2) or PMF (n=1); 2 patients harbored CALR type 1 driver mutation, while one patient carried JAK2V617F variant. In all patients, the first mutational hit occurred on epigenetic remodeler genes (i.e. TET2, ASXL1). Driver mutations’ allele frequency remained stable during disease progression and did not seem to drive leukemic transformation; in one case, JAK2V617F variant was lost in blast phase. In one patient, single cell analysis revealed the acquisition of 3 mutually exclusive pathogenic variants in RAS pathway (two NRAS mutations and a KRAS mutation). Notably, leukemic driver mutations, affecting genes such as IDH2, TP53 and KRAS, were already traceable at very low allele frequency in the chronic phase of the disease of all patients, despite being undetectable by bulk diagnostic NGS analysis. For all patients, CNV analysis highlighted a higher gene dosage imbalance in the leukemic clones when compared with those in the chronic phase. Preliminary analysis of single cell ATAC+RNAseq data showed that the leukemic sample is enriched in more primitive cell types (e.g. multipotent progenitors). Moreover, genes found to be upregulated and more accessible in blast phase erythroid progenitors and HSC clusters are associated with AML poor prognosis. Summary/Conclusion: Altogether this analysis suggests that MPNs’ first mutational hit frequently occurs in chromatin remodeler genes and affects a large fraction of neoplastic cells, confirming their impact on MPNs pathogenesis. Single cell multiomic analysis suggests that epigenetic alterations contribute to alter CD34+ cells differentiation state and activate the expression of pro-leukemic genes. Moreover, genomic analysis highlighted that clones carrying driver mutations remain stable during time and do not seem to drive leukemic transformation. On the other hand, genetic alterations, such as SNVs and CNVs, driving AML evolution are early identified by single cell analysis despite being undetectable by bulk sequencing.

Patients With Myeloproliferative Neoplasms Harbor High Frequencies of CD8 T Cell-Platelet Aggregates Associated With T Cell Suppression.

Myeloproliferative neoplasms (MPN) are chronic cancers of the hematopoietic stem cells in the bone marrow, and patients often harbor elevated numbers of circulating platelets (PLT). We investigated the frequencies of circulating PLT-lymphocyte aggregates in MPN patients and the effect of PLT-binding on CD8 T cell function. The phenotype of these aggregates was evaluated in 50 MPN patients and 24 controls, using flow cytometry. In vitro studies compared the proliferation, cytokine release, and cytoxicity of PLT-bound and PLT-free CD8 T cells. Frequencies of PLT-CD8 T cell aggregates, were significantly elevated in MPN patients. Advanced disease stage and CALR mutation associated with the highest aggregate frequencies with a predominance of PLT-binding to antigen-experienced CD8 T cells. PLT-bound CD8 T cells showed reduction in proliferation and cytotoxic capacity. Our data suggest that CD8 T cell responses are jeopardized in MPN patients. JAK2 and CALR exon 9 mutations – the two predominant driver mutations in MPN – are targets for natural T cell responses in MPN patients. Moreover, MPN patients have more infections compared to background. Thus, PLT binding to antigen experienced CD8 T cells could play a role in the inadequacy of the immune system to control MPN disease progression and prevent recurrent infections.

Driver Mutations in Myeloproliferative Neoplasms Occur Early in Life

Mutations in common driver genes of myeloproliferative neoplasms often occur in childhood.

[Myeloproliferative neoplasms and vascular diseases].

Vascular diseases are a feature of myeloproliferative neoplasms (MPNs) with a driver mutation, such as JAK2V617F. There is growing evidence that clonal hematopoiesis with JAK2V617F (JAK2V617F-CH) is often complicated with vascular diseases, even in the absence of MPN onset. Such vascular diseases associated with the MPN driver mutation include arterial/venous thrombosis, atherosclerotic coronary artery disease and aortic aneurysm, and pulmonary hypertension. Murine studies have recently revealed mechanisms by which hematopoietic cells activated by the MPN driver mutation may promote thrombosis and vascular remodeling in deep vein stenosis, atherosclerosis, and pulmonary hypertension models. Furthermore, MPN driver mutations mediate various downstream molecules of JAK-STAT activation in neutrophils and macrophages, such as inflammatory cytokines, which may be candidates for preventing and treating vascular diseases in MPNs and JAK2V617F-CH.

Targets in MPNs and potential therapeutics.

Philadelphia-negative classical Myeloproliferative Neoplasms (MPNs), including Polycythemia Vera (PV), Essential Thrombocythemia (ET) and Primary Myelofibrosis (PMF), are clonal hemopathies that emerge in the hematopoietic stem cell (HSC) compartment. MPN driver mutations are restricted to specific exons (14 and 12) of Janus kinase 2 (JAK2), thrombopoietin receptor (MPL/TPOR) and calreticulin (CALR) genes, are involved directly in clonal myeloproliferation and generate the MPN phenotype. As a result, an increased number of fully functional erythrocytes, platelets and leukocytes is observed in the peripheral blood. Nevertheless, the complexity and heterogeneity of MPN clinical phenotypes cannot be solely explained by the type of driver mutation. Other factors, such as additional somatic mutations affecting epigenetic regulators or spliceosomes components, mutant allele burdens and modifiers of signaling by driver mutants, clonal architecture and the order of mutation acquisition, signaling events that occur downstream of a driver mutation, the presence of specific germ-line variants, the interaction of the neoplastic clone with bone marrow microenvironment and chronic inflammation, all can modulate the disease phenotype, influence the MPN clinical course and therefore, might be useful therapeutic targets.